Primers:
| 1680 | Flk_HSP70_FWD | GACCCGGATGTCCAGAGGAA | JH | 6/9/2015 | 20 | 60 | O.lurida | HSP70 Flanking | ||
| 1679 | Flk_HSP70_REV | TCAGGACGGCTTGTGAACG | JH | 6/9/2015 | 19 | 60 | O.lurida | |||
| 1678 | Flk_Actin_FWD | TCGAGGGAGGAAGAGGAAGC | JH | 6/9/2015 | 20 | 59 | O.lurida | Actin Flanking | ||
| 1677 | Flk_Actin_REV | AACTGGGACGACATGGAGAA | JH | 6/9/2015 | 20 | 61 | O.lurida | |||
| 1666 | Flk_HSPb11_FWD | AGAATTGTCTGTGGAATCGAGC | JH | 6/1/2015 | 22 | 59 | O.lurida | HSPb11 Flanking | Q9Y547 | |
| 1665 | Flk_HSPb11_REV | ATCAACGCCAGGGGAACTTG | JH | 6/1/2015 | 20 | 61 | O.lurida | Q9Y547 | ||
| 1664 | Flk_PGE/EP4_FWD | GCTCAACGAATTGCTCTACTCC | JH | 6/1/2015 | 22 | 59 | O.lurida | PGE/EP4 Flanking | P32240 | |
| 1663 | Flk_PGE/EP4_REV | TCCGTCTGCTTTTTAGAATGGTA | JH | 6/1/2015 | 23 | 58 | O.lurida | P32240 | ||
| 1668 | Flk_BMP2_FWD | GGCTGGCTGGATCGTCAT | JH | 6/1/2015 | 18 | 60 | O.lurida | BMP2 Flanking | P12643 | |
| 1667 | Flk_BMP2_REV | ATGGAGTCTGTGGACGGTTTG | JH | 6/1/2015 | 21 | 60 | O.lurida | P12643 |
Reagent Table:
| Reaction_Components | Volume | Final Concentration |
| 2x Apex Red | 12.5 | 125 |
| Forward Primer (10uM) | 0.5 | 5 |
| Reverse Primer (10uM) | 0.5 | 5 |
| H20 | 10.5 | 105 |
| Template | 1 |
Using the final concentration I mixed each master mix going from largest to smallest volume.
I then pipetted 24 ul in each well followed by 1 ul of water or sample depending.
Then I ran the following PCR program:
| Temp | Time |
| 95 C | 5 min |
| 95 C | 30 sec |
| 55 C | 30 sec |
| 72 C | 30 sec |
| repeat steps 2-4 40 times | |
| 72 C | 3 min |
| 4 C | Hold |
Once the PCR finished I ran 25 ul of each product on a 1.3% agarose gel
Gel Reagent Table
| Reagent | Volume |
| 1X Low TAE | 175 ml |
| Agarose | 2.3 g |
| EtBr | 17.5 ul |
- Add agarose to TAE.
- Microwave 1 minute stir
- Repeat until no particulate matter in solution
- Add EtBr while agarose still hot
- Gently pour in one corner of the gel cast until tray is full
I then ran the gel at 100 v for 40 minutes. I placed it on the transilluminator to view any bands that may have formed. The gel is below
Gel Layout:
| Actin | HSP70 | ||||||||||||||||||
| Ladder | HC1 | NC1 | SC1 | HT1 | NT1 | ST1 | NTC | Ladder | HC1 | NC1 | SC1 | HT1 | NT1 | ST1 | NTC | Empty | Empty | Empty | Empty |
| PGEEP4 | HSPb11 | ||||||||||||||||||
| Ladder | HC1 | NC1 | SC1 | HT1 | NT1 | ST1 | NTC | Ladder | HC1 | NC1 | SC1 | HT1 | NT1 | ST1 | NTC | Empty | Empty | Empty | Empty |
| BMP2 | |||||||||||||||||||
| Ladder | HC1 | NC1 | SC1 | HT1 | NT1 | ST1 | NTC | Empty | Empty | Empty | Empty | Empty | Empty | Empty | Empty | Empty | Empty | Empty | Empty |
It appears the Actin flanking primer failed hard. The HSP70 primer seemed to do pretty well but still created several smaller bands. I carefully extracted only the largest band from the HSP70 samples to ensure that it was the right product. The rest of the primers worked like the had previously.
Once the bands were cut out of the gel and placed in a Millipore Purification Column and centrifuged at 5,000 rcf for 10 minutes to collect the purified DNA.
To send them off for sequencing I plated 4 replicates of 10 ul for each sample in the appropriate tube. On a second plate I plated two replicates of 3 uM primer working stock for each appropriate sample. These plates are now being held in the 4 C in 213 for sequencing.
Sam's last sequencing came back today and it appears there are more primers that need to be re amplified and sequenced I will work on that tomorrow. I will also make sure to send off the TLR2.1 samples as they were overlooked in the last batch.
No comments:
Post a Comment