6 23 2015 TLR2.1 qPCR

Yesterday after discovering that the Opticon was acting up, I decided to run a couple qPCR's on the Biorad CFX in the Friedman lab. The first was the TLR2.1 gene which had not been present in the Dabob population during the initial primer checks.

Primer:

1630	TLR2.1_FWD	ACAAAGATTCCACCCGGCAA	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78
1629	TLR2.1_REV	ACACCAACGACAGGAAGTGG	JH	5/21/2015	20	55		O.lurida	Toll-like receptor 2 type-1	Q9DD78

Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 19 ul Master Mix to each tube
5. Pipetted appropriate cDNA sample to each tube
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All Samples

NTCs

So the graph doesn't really do justice for the results. There is amplification in a majority of samples but interestingly only about half of the Dabob population shows expression of this allele. The other half show absolutely no expression. There are a few individuals which show a very low expression of this allele but others show some of the highest expression. Overall this is pretty confusing and may be indicative that the Dabob population is more heterogeneous for this allele than the other populations. After running this qPCR, I ran another Actin qPCR using the friedman machine to create a normalizing standard which I will talk about in my next post.

You can view the raw data here.