Primers:
1636 | CRAF1_FWD | AGCAGGGCATCAAACTCTCC | JH | 5/21/2015 | 20 | 55 | O.lurida | TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN) | Q60803 | |
1635 | CRAF1_REV | ACAAGTCGCACTGGCTACAA | JH | 5/21/2015 | 20 | 55 | O.lurida | TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN) | Q60803 |
Reagent Table:
Volume | Reactions X58 | |
Ssofast Evagreen MM | 10 | 580 |
FWD Primer | 0.5 | 29 |
REV Primer | 0.5 | 29 |
Nuclease Free H2O | 8 | 464 |
cDNA | 1 |
- Added reagents from greatest to least volume
- Vortexed
- Centrifuged briefly
- Pipetted 19 ul Master Mix to each tube
- Pipetted appropriate cDNA sample to each tube
- Centrifuged plate at 2000 rpm for 1 minute
- Ran Program Below
Program:
Step | Temperature | Time |
Initiation | 95 C | 10 min |
Elongation | 95 C | 30 sec |
60 C | 1 min | |
Read | ||
72 C | 30 sec | |
Read | ||
Repeat Elongation 39 times | ||
Termination | 95 C | 1 min |
55 C | 1 sec | |
Melt Curve Manual ramp 0.2C per sec Read 0.5 C | 55 - 95 C | 30 sec |
21 C | 10 min | |
End |
Plate Layout:
1 | 2 | 3 | 4 | 5 | 6 | 7 |
DNased 42215 HC1 | DNased 42215 NC1 | DNased 42215 SC1 | DNased 42215 HT1 1 | DNased 42215 NT1 1 | DNased 42215 ST1 1 | NTC |
DNased 42215 HC2 | DNased 42215 NC2 | DNased 42215 SC2 | DNased 42215 HT1 2 | DNased 42215 NT1 2 | DNased 42215 ST1 2 | NTC |
DNased 42215 HC3 | DNased 42215 NC3 | DNased 42215 SC3 | DNased 42215 HT1 3 | DNased 42215 NT1 3 | DNased 42215 ST1 3 | NTC |
DNased 42215 HC4 | DNased 42215 NC4 | DNased 42215 SC4 | DNased 42215 HT1 4 | DNased 42215 NT1 4 | DNased 42215 ST1 4 | NTC |
DNased 42215 HC5 | DNased 42215 NC5 | DNased 42215 SC5 | DNased 42215 HT1 5 | DNased 42215 NT1 5 | DNased 42215 ST1 5 | |
DNased 42215 HC6 | DNased 42215 NC6 | DNased 42215 SC6 | DNased 42215 HT1 6 | DNased 42215 NT1 6 | DNased 42215 ST1 6 | |
DNased 42215 HC7 | DNased 42215 NC7 | DNased 42215 SC7 | DNased 42215 HT1 7 | DNased 42215 NT1 7 | DNased 42215 ST1 7 | |
DNased 42215 HC8 | DNased 42215 NC8 | DNased 42215 SC8 | DNased 42215 HT1 8 | DNased 42215 NT1 8 | DNased 42215 ST1 8 |
Results:
All Samples
It looks like there was some contamination in the first NTC well but it wasn't present in the other three wells. THe result here are definitely interesting as there appears to be a pretty big difference between samples. More analysis is needed to tease out this info.
You can see the raw data here.
You can see the raw data here.
No comments:
Post a Comment