Primers:
| 1640 | BMP-2_FWD | TGAAGGAACGACCAAAGCCA | JH | 5/21/2015 | 20 | 55 | O.lurida | Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A) | P12643 | |
| 1639 | BMP-2_REV | TCCGGTTGAAGAACCTCGTG | JH | 5/21/2015 | 20 | 55 | O.lurida | Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A) | P12643 |
Reagent Table:
| Volume | Reactions X80 | |
| Ssofast Evagreen MM | 10 | 800 |
| FWD Primer | 0.5 | 40 |
| REV Primer | 0.5 | 40 |
| 1:9 cDNA | 9 |
- Added reagents from greatest to least volume
- Vortexed
- Centrifuged briefly
- Pipetted 11 ul Master Mix to each tube using a multichannel pipetter
- Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
- Centrifuged plate at 2000 rpm for 1 minute
- Ran Program Below
Program:
| Step | Temperature | Time |
| Initiation | 95 C | 10 min |
| Elongation | 95 C | 30 sec |
| 60 C | 1 min | |
| Read | ||
| 72 C | 30 sec | |
| Read | ||
| Repeat Elongation 39 times | ||
| Termination | 95 C | 1 min |
| 55 C | 1 sec | |
| Melt Curve Manual ramp 0.2C per sec Read 0.5 C | 55 - 95 C | 30 sec |
| 21 C | 10 min | |
| End |
Plate Layout:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 |
| DNased 42215 HC1 | DNased 42215 NC1 | DNased 42215 SC1 | DNased 42215 HT1 1 | DNased 42215 NT1 1 | DNased 42215 ST1 1 | DNased 42215 HM1 1 | DNased 42215 NM1 1 | DNased 42215 SM1 1 | NTC |
| DNased 42215 HC2 | DNased 42215 NC2 | DNased 42215 SC2 | DNased 42215 HT1 2 | DNased 42215 NT1 2 | DNased 42215 ST1 2 | DNased 42215 HM1 2 | DNased 42215 NM1 2 | DNased 42215 SM1 2 | NTC |
| DNased 42215 HC3 | DNased 42215 NC3 | DNased 42215 SC3 | DNased 42215 HT1 3 | DNased 42215 NT1 3 | DNased 42215 ST1 3 | DNased 42215 HM1 3 | DNased 42215 NM1 3 | DNased 42215 SM1 3 | NTC |
| DNased 42215 HC4 | DNased 42215 NC4 | DNased 42215 SC4 | DNased 42215 HT1 4 | DNased 42215 NT1 4 | DNased 42215 ST1 4 | DNased 42215 HM1 4 | DNased 42215 NM1 4 | DNased 42215 SM1 4 | NTC |
| DNased 42215 HC5 | DNased 42215 NC5 | DNased 42215 SC5 | DNased 42215 HT1 5 | DNased 42215 NT1 5 | DNased 42215 ST1 5 | DNased 42215 HM1 5 | DNased 42215 NM1 5 | DNased 42215 SM1 5 | |
| DNased 42215 HC6 | DNased 42215 NC6 | DNased 42215 SC6 | DNased 42215 HT1 6 | DNased 42215 NT1 6 | DNased 42215 ST1 6 | DNased 42215 HM1 6 | DNased 42215 NM1 6 | DNased 42215 SM1 6 | |
| DNased 42215 HC7 | DNased 42215 NC7 | DNased 42215 SC7 | DNased 42215 HT1 7 | DNased 42215 NT1 7 | DNased 42215 ST1 7 | DNased 42215 HM1 7 | DNased 42215 NM1 7 | DNased 42215 SM1 7 | |
| DNased 42215 HC8 | DNased 42215 NC8 | DNased 42215 SC8 | DNased 42215 HT1 8 | DNased 42215 NT1 8 | DNased 42215 ST1 8 | DNased 42215 HM1 8 | DNased 42215 NM1 8 | DNased 42215 SM1 8 |
All
NTCs
The amplification curves look great but the melt curves have the bump that always shows up. The NTCs have no appreciable amplification when compared to the samples.


No comments:
Post a Comment