8 14 2015 BMP2 CTM reps qPCR 2

Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran BMP2.

Primers:

1640	BMP-2_FWD	TGAAGGAACGACCAAAGCCA	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643
1639	BMP-2_REV	TCCGGTTGAAGAACCTCGTG	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643

Reagent Table:

	Volume	Reactions X80
Ssofast Evagreen MM	10	800
FWD Primer	0.5	40
REV Primer	0.5	40
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube using a  multichannel pipetter
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7	8	9	10
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5	DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6	DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7	DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8	DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

All 

NTCs

The amplification curves look great but the melt curves have the bump that always shows up. The NTCs have no appreciable amplification when compared to the samples. 

You can see the raw ct values here and the raw data file here.