8 18 2015 18s/28s primer check qPCR

While looking for new normalizing primers to add to the EF1d and actin that I already have I've developed primers for 18s and 28s. The 18s are based on sequences for Ostrea conchaphila. The 28s primer is developed from the 28s sequence from the O.lurida Transcriptome version 3. I tested these primers on the mechanical stress samples in a 1:9 dilution.

Primers:

1702	28s_3_FWD	TAAGGCCAGTGTGGGAGAGA	JH	8/12/2015	20	55	59.88	O.lurida	"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"	Q5REJ1
1701	28s_3_REV	CGCCTCACTTTTTGTGCCTC	JH	8/12/2015	20	55	60.04	O.lurida	"28S ribosomal protein S5, mitochondrial (MRP-S5) (S5mt)"	Q5REJ1
1700	18s_2_FWD	CTCGATTCCCTTTCCCCCAC	JH	8/12/2015	20	60	60.11	O.conchaphila	18s Ribosomal RNA	EF035117.1
1699	18s_2_REV	GCCCGATCTCTTTCCACCTC	JH	8/12/2015	20	60	60.18	O.conchaphila	18s Ribosomal RNA	EF035117.1
1698	18s_1_FWD	TTCCTTTTCCCCCACTCAGC	JH	8/12/2015	20	55	59.89	O.conchaphila	18s Ribosomal RNA	EF035118.1
1697	18s_1_REV	CGCTTCACTCGCCGTTACTA	JH	8/12/2015	20	55	60.18	O.conchaphila	18s Ribosomal RNA	EF035118.1

Reagent Table:

	Volume	Reactions X10
Ssofast Evagreen MM	10	100
FWD Primer	0.5	5
REV Primer	0.5	5
PCR H2O	5	50
1:9 cDNA	4

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 16 ul Master Mix to each tube
5. Pipetted 4 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Table Layout:

18s_1	18s_2	28s_3
1	2	3	4	5
DNased 42215 HM1 1	DNased 42215 NM1 1	DNased 42215 SM1 1	18s_1_NTC	18s_1_NTC
DNased 42215 HM1 2	DNased 42215 NM1 2	DNased 42215 SM1 2	18s_2_NTC	18s_2_NTC
DNased 42215 HM1 3	DNased 42215 NM1 3	DNased 42215 SM1 3	28s_3_NTC	28s_3_NTC
DNased 42215 HM1 4	DNased 42215 NM1 4	DNased 42215 SM1 4
DNased 42215 HM1 5	DNased 42215 NM1 5	DNased 42215 SM1 5
DNased 42215 HM1 6	DNased 42215 NM1 6	DNased 42215 SM1 6
DNased 42215 HM1 7	DNased 42215 NM1 7	DNased 42215 SM1 7
DNased 42215 HM1 8	DNased 42215 NM1 8	DNased 42215 SM1 8

18s_1

All

NTC

18s_2

All

NTC

28s_3

All

NTC

The 18s primers each have issues. The first has seemingly random amplification and poor melt curves. The second seems to autoamplify and has NTCs with amplification equal to the samples. 

The 28s primer looks great. It has strong amplification with only primer dimers appearing in the NTCs. I think this should be used for the next normalizing primers.