6 22 2015 Actin qPCR

Last night I ran a qPCR on Actin using the 48 cDNA samples produced by Sam. I ran it using the same procedure as I did for the CARM samples yesterday morning so that I can use it as a normalizing gene.

Primer Used:

1505	Ol_Act_F	GACCAGCCAAATCCAGACGA	BC	6/13/2012	20	55	60	O.lurida	Actin, adductor muscle
1504	Ol_Act_R	CGGTCGTACCACTGGTATCG		6/13/2012	20	60	60	O.lurida	Actin, adductor muscle

Master Mix Reagent Table:

	Volume	Reactions X58
Ssofast Evagreen MM	10	580
FWD Primer	0.5	29
REV Primer	0.5	29
Nuclease Free H2O	8	464
cDNA	1

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 19 ul Master Mix to each tube
5. Pipetted appropriate cDNA sample to each tube
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

qPCR Program:

Sybr New Plate+Sybr cDNA 60 melt 2 Read
Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

Amplification

 Melt Curve

As you can see the amplification and melt curves look good. Upon closer examination I did notice however that the rows at the top and bottom had much lower amplification than those in the middle. This is concerning as it could be giving me false values for samples in these spots. I've decided to forego using the Opticon and have now run samples on the BioRad in the Friedman lab in FSH. 

You can see the raw data file here.