6 25 2015 Flanking PCR pt 4

Yesterday I ran a PCR for some flanking primers that failed to get good coverage based on Steven's analysis. Today I ran the products on a gel and excised the bands for sanger sequencing.

Primers:

1660	Flk_GRB2_FWD	TCAGAACTGGTTCAAAGCTGAGT	JH	6/1/2015	23		60	O.lurida	GRB2 Flanking	P62994
1659	Flk_GRB2_REV	ACTGCGCTGACATACTGGAC	JH	6/1/2015	20		60	O.lurida		P62994
1658	Flk_H3.3_FWD	CCAATGACAAATGAGCCACACAA	JH	6/1/2015	23		60	O.lurida	H3.3 Flanking	Q6P823
1657	Flk_H3.3_REV	TCGTACAAAGCAAACTGCACG	JH	6/1/2015	21		60	O.lurida		Q6P823
1656	Flk_H2A.V_FWD	GCGATGGAGTTGATGAGGTG	JH	6/1/2015	20		59	O.lurida	H2A.V Flanking	P08991
1655	Flk_H2A.V_REV	CAAGGCAGTTTCTCGTTCGG	JH	6/1/2015	20		59	O.lurida		P08991
1652	Flk_p29ING_FWD	GTGGACACACATGCACTCCT	JH	6/1/2015	20		60	O.lurida	p29ING4 Flanking	Q8C0D7
1651	Flk_p29ING_REV	AAGCAGACTCAGATTCAGGC	JH	6/1/2015	20		58	O.lurida		Q8C0D7

Reagent Table:

Reaction_Components	Volume	Final Concentration
2x Apex Red	12.5	125
Forward Primer (10uM)	0.5	5
Reverse Primer (10uM)	0.5	5
H20	10.5	105
Template	1

Using the final concentration I mixed each master mix going from largest to smallest volume. 

I then pipetted 24 ul in each well followed by 1 ul of water or sample depending. 

Then I ran the following PCR program:

Temp	Time
95 C	5 min
95 C	30 sec
55 C	30 sec
72 C	30 sec
repeat steps 2-4 40 times
72 C	3 min
4 C	Hold

Once the PCR finished I ran 25 ul of each product on a 1.3% agarose gel

Gel Reagent Table

Reagent	Volume
1X Low TAE	175 ml
Agarose	2.3 g
EtBr	17.5 ul

1. Add agarose to TAE.
2. Microwave 1 minute stir
3. Repeat until no particulate matter in solution
4. Add EtBr while agarose still hot
5. Gently pour in one corner of the gel cast until tray is full 

I then ran the gel at 100 v for 40 minutes. I placed it on the transilluminator to view any bands that may have formed. In my haste I forgot to image the gel, Luckily the gel ran fine with strong banding and minor streaking due to over filled wells. 

After running the gel I excised the bands. Once the bands were cut out of the gel and placed in a Millipore Purification Column and centrifuged at 5,000 rcf for 10 minutes to collect the purified DNA. 

To send them off for sequencing I plated 4 replicates of 10 ul for each sample in the appropriate tube. On a second plate I plated two replicates of 3 uM primer working stock for each appropriate sample. These plates are now being held in the 4 C in 213 for sequencing.