6 24 2015 qPCR Quality Check

Today I ran a qPCR quality check to determine if our Opticon two is producing valid data. I did this because the other day we noticed a discrepancy with the data that showed samples in the top and bottom rows had lower expression than those in the middle rows. To test if the machine was working properly I made a master mix including a template of isolated gDNA that I know amplifies and equally distributed it across the plate.

Primer:

1505	Ol_Act_F	GACCAGCCAAATCCAGACGA	BC	6/13/2012	20	55	60	O.lurida	Actin, adductor muscle
1504	Ol_Act_R	CGGTCGTACCACTGGTATCG		6/13/2012	20	60	60	O.lurida	Actin, adductor muscle

Reagent Table:

	Volume	Reactions X52
Ssofast Evagreen MM	10	520
FWD Primer	0.5	26
REV Primer	0.5	26
Nuclease Free H2O	8	416
gDNA	1	52

The sample I used was from Oly seed oyster isolations I did a while back. 

Sample Info:

Sample ID	Date	Time	ng/ul
NF20	5/7/2015	11:17 AM	876.31

To make the master mix I added all the reagents together from greatest volume to least volume and then added the gDNA template. I vortexed briefly to ensure homogeneous mixture. I then pipetted 20 ul of this mixture into every other well to make a checker board pattern on the plate. 

Plate Layout:

1	2	3	4	5	6	7	8	9	10	11	12
Sample		Sample		Sample		Sample		Sample		Sample
	Sample		Sample		Sample		Sample		Sample		Sample
Sample		Sample		Sample		Sample		Sample		Sample
	Sample		Sample		Sample		Sample		Sample		Sample
Sample		Sample		Sample		Sample		Sample		Sample
	Sample		Sample		Sample		Sample		Sample		Sample
Sample		Sample		Sample		Sample		Sample		Sample
	Sample		Sample		Sample		Sample		Sample		Sample

This pattern was to test the machines fluorescence reading capabilities across the entire plate without having to fill every well with sample. 

I ran the following program which is the same for all the other qPCR's that I have been running.

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Results:

Amplification

Melt Curve

 Plate Fluorescence

As you can see from the amplification, while all of the well should have had exactly the same amplification there was a significant difference between wells with some wells being orders of magnitude higher. The melt curve shows similar. My favorite image though is the plate fluorescence which shows a rough estimate of the fluorescence detected in each well by the machine. Clearly the center wells have higher fluorescence detection than wells along the edges of the plate. At this time it is apparent that we need to recalibrate the Opticon as it clearly is not producing valid data.