Primers:
1509 | Ol_Ef1a_F | TCCTTGTTCAAACCCTTCATGT | BC | 6/13/2012 | 22 | 40.9 | 58.1 | O.lurida | Elongation factor 1-alpha |
1508 | Ol_Ef1a_R | CAAACCCTTGCCTCGGTAAG | BC | 6/13/2012 | 20 | 55 | 58.8 | O.lurida | Elongation factor 1-alpha |
Reagent Table:
Volume | Reactions X116 | |
Ssofast Evagreen MM | 10 | 1160 |
FWD Primer | 0.5 | 58 |
REV Primer | 0.5 | 58 |
1:9 cDNA | 9 |
- Added reagents from greatest to least volume
- Vortexed
- Centrifuged briefly
- Pipetted 11 ul Master Mix to each tube
- Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
- Centrifuged plate at 2000 rpm for 1 minute
- Ran Program Below
Program:
Step | Temperature | Time |
Initiation | 95 C | 10 min |
Elongation | 95 C | 30 sec |
60 C | 1 min | |
Read | ||
72 C | 30 sec | |
Read | ||
Repeat Elongation 39 times | ||
Termination | 95 C | 1 min |
55 C | 1 sec | |
Melt Curve Manual ramp 0.2C per sec Read 0.5 C | 55 - 95 C | 30 sec |
21 C | 10 min | |
End |
Plate Layout:
1 | 2 | 3 | 4 | 5 | 6 | 7 |
DNased 42215 HC1 | DNased 42215 NC1 | DNased 42215 SC1 | DNased 42215 HT1 1 | DNased 42215 NT1 1 | DNased 42215 ST1 1 | NTC |
DNased 42215 HC2 | DNased 42215 NC2 | DNased 42215 SC2 | DNased 42215 HT1 2 | DNased 42215 NT1 2 | DNased 42215 ST1 2 | NTC |
DNased 42215 HC3 | DNased 42215 NC3 | DNased 42215 SC3 | DNased 42215 HT1 3 | DNased 42215 NT1 3 | DNased 42215 ST1 3 | NTC |
DNased 42215 HC4 | DNased 42215 NC4 | DNased 42215 SC4 | DNased 42215 HT1 4 | DNased 42215 NT1 4 | DNased 42215 ST1 4 | NTC |
DNased 42215 HC5 | DNased 42215 NC5 | DNased 42215 SC5 | DNased 42215 HT1 5 | DNased 42215 NT1 5 | DNased 42215 ST1 5 | |
DNased 42215 HC6 | DNased 42215 NC6 | DNased 42215 SC6 | DNased 42215 HT1 6 | DNased 42215 NT1 6 | DNased 42215 ST1 6 | |
DNased 42215 HC7 | DNased 42215 NC7 | DNased 42215 SC7 | DNased 42215 HT1 7 | DNased 42215 NT1 7 | DNased 42215 ST1 7 | |
DNased 42215 HC8 | DNased 42215 NC8 | DNased 42215 SC8 | DNased 42215 HT1 8 | DNased 42215 NT1 8 | DNased 42215 ST1 8 |
Results:
All samples
NTCs
It appears that this run failed hard. There was no strong amplification in the samples. The NTCs had no amplification either. I only saw this data after I started the second replicate. I don't expect it to do much better. I think a trial with H3.3, H2A, and H2A.V could show if they would be good normalizing genes. I'll run them tomorrow. I'll post about the second elongation run when it finishes.
You can see the raw data here.
No comments:
Post a Comment