7 23 2015 PGE/EP4 qPCR 2

Today I ran duplicates for the targets I ran last week. I'm hoping to get strong replicates for analysis. Here I ran the PGE/EP4 which last week had issues with the NTC. 

Primers:

1638	PGE/EP4_FWD	ACAGCGACGGACGATTTTCT	JH	5/21/2015	20	55		O.lurida	Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)	P32240
1637	PGE/EP4_REV	ATGGCAGACGTTACCCAACA	JH	5/21/2015	20	55		O.lurida	Prostaglandin E2 receptor EP4 subtype (PGE receptor EP4 subtype) (PGE2 receptor EP4 subtype) (Prostanoid EP4 receptor)	P32240

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All samples

Amp

Melt Curve

NTCs

Amp

Melt Curve

The curves look good with no amplification in the NTCs. To check this run compared to the previous one, I pulled the Ct values and graphed them against one another.

The reps dont look great with alot of the second reps samples failing to amplify. I'm not sure what's causing these huge numbers of failures with the data. I'll probably need to rerun this on the CFX machine.

You can see the raw data here.