7 16 2015 HSP70 qPCR

Today I started running more targets that may be of interest due expected changes in expression. Here I explore HSP70 which is expected to have increased expression due to exposure to increased temperatures. 

Primers:
HSP70 
FWD - TTGTCGCCATTTTCCTCGCT
REV - GTTCCGATTTGTTCCGTGCC

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All samples

NTCs

This looks interesting in terms of expression, there is some amplification in the NTCs but it was a product much larger than the target. To see if there are any interesting expression levels I ran this through an ANOVA and Tukey's HSD to produce any significant differences between the treatment, control, and populations. 

Call:

   aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

Terms:

                         Pop        Treat    Pop:Treat    Residuals

Sum of Squares  7.777300e-20 1.174464e-19 7.510100e-20 2.988660e-18

Deg. of Freedom            2            1            2           41

Residual standard error: 2.699892e-10

Estimated effects may be unbalanced

1 observation deleted due to missingness

> TukeyHSD(fit)

  Tukey multiple comparisons of means

    95% family-wise confidence level

Fit: aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

$Pop

            p adj

N-H  0.6768333

S-H  0.6234033

S-N  0.9972407

$Treat

              p adj

T-C  0.2116992

$`Pop:Treat`

                   p adj

N:C-H:C   0.9999993

S:C-H:C  1.0000000

H:T-H:C  0.9999997

N:T-H:C   0.8823690

S:T-H:C   0.8051192

S:C-N:C  0.9999986

H:T-N:C  0.9999855

N:T-N:C   0.9123072

S:T-N:C   0.8463452

H:T-S:C  0.9999999

N:T-S:C   0.8771414

S:T-S:C   0.7981469

N:T-H:T   0.8524787

S:T-H:T   0.7660122

S:T-N:T   0.9999953

There's no significant differences between anything which is very surprising as I would expect at least a strong difference between treatment and control. Steven has suggested that this primer may not actually be for HSP70 since we did not develop it. These results seem to confirm it though. The expression graph produced from the expression data doesn't seem to be of any help either. I think I may need to go redevelop some primers for HSP70 to hopefully get one that works. 

You can see the raw data here.