7 20 2015 p29ING qPCR

Today I ran more targets that may be of interest due expected changes in expression. Here I explore p29ING which is expected to have increased expression due to exposure to increased temperatures. 

Primers:

1624	p29ING4_FWD	TACCTTTGGGCTTCACCGTC	JH	5/21/2015	20	55		O.lurida	Inhibitor of growth protein 4 (p29ING4)	Q8C0D7
1623	p29ING4_REV	GTCCATCACACACCCCTCAG	JH	5/21/2015	20	55		O.lurida	Inhibitor of growth protein 4 (p29ING4)	Q8C0D7

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All samples

NTCs

These amplification curves look much better than the GRB2. There is some minor amplification in 2 of the 4 NTCs but the product was smaller than the target. The one weird issue is that one sample has a double peak in the melt curve. I'm not sure what caused this as it doesn't appear anywhere else. It may be something odd with the gene being expressed. I then analyzed the data with my stats and graphs script to see what the significant differences are. 

Adjusted Expression Bargraph

Adjusted Statistics

One Way ANOVA comparing Population Controls 

Call:

   aov(formula = expression ~ Pop, data = rep2res2[Treat == "C"])

Terms:

                         Pop    Residuals

Sum of Squares  1.026249e-21 2.641735e-21

Deg. of Freedom            2           21

Residual standard error: 1.121592e-11

Estimated effects may be unbalanced

> TukeyHSD(fit2)

  Tukey multiple comparisons of means

    95% family-wise confidence level

Fit: aov(formula = expression ~ Pop, data = rep2res2[Treat == "C"])

$Pop

             diff           lwr          upr     p adj

N-H  0.1997946

S-H   0.5595058

S-N   0.0263669

Only the Oyster Bay was significantly different from Fidalgo in the control group.The bloxplot represents this very well.  

Adjusted Expression Boxplot

You can see the raw data here.