7 8 2015 CARM rep rerun 2

Today I ran another qPCR targeting the CARM gene.  This is to hopefully improve the replicates similarly to what I was doing with the CRAF gene yesterday. To better optimize this time I made a master mix for two plates worth of samples and created both plates back to back. This is the second of the two plates. You can read about the first plate here.  

Primers:

1642	CARM1_FWD	TGGTTATCAACAGCCCCGAC	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04
1641	CARM1_REV	GTTGTTGACCCCAGGAGGAG	JH	5/21/2015	20	55		O.lurida	Histone-arginine methyltransferase CARM1 (EC 2.1.1.-) (EC 2.1.1.125) (Coactivator-associated arginine methyltransferase 1) (Protein arginine N-methyltransferase 4)	Q6DC04

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All samples

NTCs

There was amplification in all 4 NTCs just like there was in the previous plate. The products are larger than the target. I'm going to run these data through the script to see the differences between the reps. I'll post about that when its finished. 

You can see the raw data here.