7 16 2015 PGRP qPCR

Today I started running more targets that may be of interest due expected changes in expression. Here I explore PGRP which should be suppressed due to heat stress. 

Primers:

1632	PGRP-S_FWD	GAGACTTCACCTCGCACCAA	JH	5/21/2015	20	55		O.lurida	Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)	O75594
1631	PGRP-S_REV	AACTGGTTTGCCCGACATCA	JH	5/21/2015	20	55		O.lurida	Peptidoglycan recognition protein 1 (Peptidoglycan recognition protein short) (PGRP-S)	O75594

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All samples

NTCs

To check to see if these are expressed different I ran an ANOVA and Tukey's HSD. I also removed all NA's and extreme outliers to improve performance of the ANOVA and make better boxplots. 

Adjusted Expression Graph

Adjusted ANOVA/Tukey's HSD

Call:

   aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

Terms:

                         Pop        Treat    Pop:Treat    Residuals

Sum of Squares  1.023990e-26 6.074000e-27 1.899868e-25 9.509453e-25

Deg. of Freedom            2            1            2           30

Residual standard error: 1.780398e-13

Estimated effects may be unbalanced

> TukeyHSD(fit)

  Tukey multiple comparisons of means

    95% family-wise confidence level

Fit: aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

$Pop

            p adj

N-H  0.8754092

S-H  0.8861151

S-N  0.9996556

$Treat

                p adj

T-C  0.6675126

$`Pop:Treat`

                    p adj

N:C-H:C   0.4566177

S:C-H:C  0.9999965

H:T-H:C  0.9838963

N:T-H:C  0.9991194

S:T-H:C   0.8788662

S:C-N:C  0.6282287

H:T-N:C  0.8351607

N:T-N:C  0.2734918

S:T-N:C  0.9783862

H:T-S:C   0.9872158

N:T-S:C  0.9999829

S:T-S:C   0.9215598

N:T-H:T  0.9038099

S:T-H:T   0.9973751

S:T-N:T   0.7015271

There doesn't appear to be any significant differences from the ANOVA. But when looking at the boxplot it seems like there might be. 

Adjusted Boxplot

Its possible with further T-tests and 1 factor ANOVAs might find the true difference in the data. 

You can see the raw data here.