7 7 2015 CRAF rerun 2

Today I ran another qPCR targeting the CRAF gene.  This is to hopefully improve the replicates similarly to what I was doing with the Actin gene yesterday. To better optimize this time I made a master mix for two plates worth of samples and created both plates back to back. This is the second plate that I ran, you can read about the first here. 

Primers:

1636	CRAF1_FWD	AGCAGGGCATCAAACTCTCC	JH	5/21/2015	20	55		O.lurida	TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)	Q60803
1635	CRAF1_REV	ACAAGTCGCACTGGCTACAA	JH	5/21/2015	20	55		O.lurida	TNF receptor-associated factor 3 (EC 6.3.2.-) (CD40 receptor-associated factor 1) (CRAF1) (TRAFAMN)	Q60803

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All Samples

NTCs

These look really good. There is some minor amplification in the NTCs but it appears to be larger than target and amplifies at a much later cycle. I'm going to compare these two reps as I did with the Actin yesterday to see how the reps differ. I'll write up a post about that when its finished.