7 15 2015 H3.3 qPCR run normalizing gene test

Since I don't have a good normalizing gene I decided to check to see if I can create one with the primers that I have. When I ran the initial checks on histone targets, they were expressed in very similar levels across all treatments. The first is the H3.3 target. I did not run replicates because I've found that with the current procedure the replicates typically are very close.

Primer:

1610	H3.3_FWD	CACGCTCTCCTCGAATCCTC	JH	5/21/2015	20	55		O.lurida	Histone H3.3	Q6P823
1609	H3.3_REV	AAGTTGCCTTTCCAGCGTCT	JH	5/21/2015	20	55		O.lurida	Histone H3.3	Q6P823

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All samples

NTCs

The graphs really look great with little amplification in the NTCs that generate a produce larger than the target. 

To check to see if the target works as a normalizing gene I ran the raw fluorescence through the R script to see if there is any stastical differences in expression. 

Call:

   aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

Terms:

                         Pop        Treat    Pop:Treat    Residuals

Sum of Squares  2.815300e-18 5.718240e-18 2.010162e-17 5.558573e-17

Deg. of Freedom            2            1            2           42

Residual standard error: 1.150422e-09

Estimated effects may be unbalanced

> TukeyHSD(fit)

  Tukey multiple comparisons of means

    95% family-wise confidence level

Fit: aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

$Pop

            p adj

N-H   0.3728762

S-H  0.9752878

S-N  0.4934820

$Treat

            p adj

T-C  0.0437989

$`Pop:Treat`

                     p adj

N:C-H:C   0.0147134

S:C-H:C  0.9984848

H:T-H:C   0.9873039

N:T-H:C  0.9428648

S:T-H:C   0.9943919

S:C-N:C  0.0419768

H:T-N:C  0.0731341

N:T-N:C  0.0010668

S:T-N:C  0.0573493

H:T-S:C   0.9998977

N:T-S:C  0.7771138

S:T-S:C   0.9999946

N:T-H:T  0.6380232

S:T-H:T  0.9999981

S:T-N:T   0.7025093

Items in bold show significant differences. Sadly from these tests H3.3 is not good for gene normalization as the treatment and control are significantly different. Also the Fidalgo Control (NC) is significantly different from all other population controls and from Fidalgo Treatment (NT). 

On the positive side, this is great as it shows a significant different in populations at control points which changes due to heat shock. Now if I can only find a normalizing gene. 

You can see the raw data here.