Primers:
| 1650 | Hspb11_FWD | ATGTTTCCTGGTCTCCGTCA | JH | 5/21/2015 | 20 | 55 | O.lurida | Heat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25) | Q9Y547 | |
| 1649 | Hspb11_REV | CATCAACGCCAGGGGAACTT | JH | 5/21/2015 | 20 | 55 | O.lurida | Heat shock protein beta-11 (Hspb11) (Placental protein 25) (PP25) | Q9Y547 |
Reagent Table:
| Volume | Reactions X116 | |
| Ssofast Evagreen MM | 10 | 1160 |
| FWD Primer | 0.5 | 58 |
| REV Primer | 0.5 | 58 |
| 1:9 cDNA | 9 |
- Added reagents from greatest to least volume
- Vortexed
- Centrifuged briefly
- Pipetted 11 ul Master Mix to each tube
- Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
- Centrifuged plate at 2000 rpm for 1 minute
- Ran Program Below
Program:
| Step | Temperature | Time |
| Initiation | 95 C | 10 min |
| Elongation | 95 C | 30 sec |
| 60 C | 1 min | |
| Read | ||
| 72 C | 30 sec | |
| Read | ||
| Repeat Elongation 39 times | ||
| Termination | 95 C | 1 min |
| 55 C | 1 sec | |
| Melt Curve Manual ramp 0.2C per sec Read 0.5 C | 55 - 95 C | 30 sec |
| 21 C | 10 min | |
| End |
Plate Layout:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 |
| DNased 42215 HC1 | DNased 42215 NC1 | DNased 42215 SC1 | DNased 42215 HT1 1 | DNased 42215 NT1 1 | DNased 42215 ST1 1 | NTC |
| DNased 42215 HC2 | DNased 42215 NC2 | DNased 42215 SC2 | DNased 42215 HT1 2 | DNased 42215 NT1 2 | DNased 42215 ST1 2 | NTC |
| DNased 42215 HC3 | DNased 42215 NC3 | DNased 42215 SC3 | DNased 42215 HT1 3 | DNased 42215 NT1 3 | DNased 42215 ST1 3 | NTC |
| DNased 42215 HC4 | DNased 42215 NC4 | DNased 42215 SC4 | DNased 42215 HT1 4 | DNased 42215 NT1 4 | DNased 42215 ST1 4 | NTC |
| DNased 42215 HC5 | DNased 42215 NC5 | DNased 42215 SC5 | DNased 42215 HT1 5 | DNased 42215 NT1 5 | DNased 42215 ST1 5 | |
| DNased 42215 HC6 | DNased 42215 NC6 | DNased 42215 SC6 | DNased 42215 HT1 6 | DNased 42215 NT1 6 | DNased 42215 ST1 6 | |
| DNased 42215 HC7 | DNased 42215 NC7 | DNased 42215 SC7 | DNased 42215 HT1 7 | DNased 42215 NT1 7 | DNased 42215 ST1 7 | |
| DNased 42215 HC8 | DNased 42215 NC8 | DNased 42215 SC8 | DNased 42215 HT1 8 | DNased 42215 NT1 8 | DNased 42215 ST1 8 |
Results:
All samples
NTCs
These curves look good with only minor amplification in 1 of the 4 NTCs. The product of which is smaller than the target so it seems like some errant amplification.
To better understand what this data means I ran it through a script to produce expression bar graphs, Two Way ANOVA, One Way ANOVA, and T-Test to determine significant differences between populations.
Adjusted Expression Bar Graph
Adjusted ANOVAs and T-Tests
TWO WAY ANOVA OVERVIEW
Call:
aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)
Terms:
Pop Treat Pop:Treat Residuals
Sum of Squares 1.691436e-19 8.907630e-20 2.216630e-20 5.453249e-19
Deg. of Freedom 2 1 2 41
Residual standard error: 1.153283e-10
Estimated effects may be unbalanced
> TukeyHSD(fit)
Tukey multiple comparisons of means
95% family-wise confidence level
Fit: aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)
$Pop
p adj
N-H 0.0057786
S-H 0.9104947
S-N 0.0169218
$Treat
p adj
T-C 0.0133392
$`Pop:Treat`
p adj
N:C-H:C 0.0408428
S:C-H:C 0.9998018
H:T-H:C 0.9080577
N:T-H:C 0.9977017
S:T-H:C 0.9803808
S:C-N:C 0.0767914
H:T-N:C 0.0025122
N:T-N:C 0.1404431
S:T-N:C 0.0062859
H:T-S:C 0.7895896
N:T-S:C 0.9999679
S:T-S:C 0.9244313
N:T-H:T 0.7094196
S:T-H:T 0.9995389
S:T-N:T 0.8690780
ONE WAY ANOVA for CONTROL
> fit2<-aov(expression~Pop, data=rep2res2[Treat=="C"])
> fit2
Call:
aov(formula = expression ~ Pop, data = rep2res2[Treat == "C"])
Terms:
Pop Residuals
Sum of Squares 1.540748e-19 3.284131e-19
Deg. of Freedom 2 21
Residual standard error: 1.250549e-10
Estimated effects may be unbalanced
> TukeyHSD(fit2)
Tukey multiple comparisons of means
95% family-wise confidence level
Fit: aov(formula = expression ~ Pop, data = rep2res2[Treat == "C"])
$Pop
p adj
N-H 0.0258634
S-H 0.9672109
S-N 0.0436003
ONE WAY ANOVA FOR TREATMENT
> fit3<-aov(expression~Pop, data=rep2res2[Treat=="T"])
> fit3
Call:
aov(formula = expression ~ Pop, data = rep2res2[Treat == "T"])
Terms:
Pop Residuals
Sum of Squares 2.958426e-20 2.169118e-19
Deg. of Freedom 2 20
Residual standard error: 1.041422e-10
Estimated effects may be unbalanced
> TukeyHSD(fit3)
Tukey multiple comparisons of means
95% family-wise confidence level
Fit: aov(formula = expression ~ Pop, data = rep2res2[Treat == "T"])
$Pop
p adj
N-H 0.2759237
S-H 0.9344962
S-N 0.4424321
T-TEST FOR DABOB POPULATION
> fit4<-t.test(expression~Treat, data=rep2res2[Pop=="H"])
> fit4
Welch Two Sample t-test
data: expression by Treat
t = 1.6786, df = 13.27, p-value = 0.1166
alternative hypothesis: true difference in means is not equal to 0
95 percent confidence interval:
-1.674696e-11 1.345441e-10
sample estimates:
mean in group C mean in group T
1.130039e-10 5.410532e-11
T-TEST FOR FIDALGO POPULATION
> fit5<-t.test(expression~Treat, data=rep2res2[Pop=="N"])
> fit5
Welch Two Sample t-test
data: expression by Treat
t = 1.811, df = 12.883, p-value = 0.09351
alternative hypothesis: true difference in means is not equal to 0
95 percent confidence interval:
-2.924424e-11 3.307085e-10
sample estimates:
mean in group C mean in group T
2.901428e-10 1.394107e-10
T-TEST FOR OYSTER BAY POPULATION
> fit6<-t.test(expression~Treat, data=rep2res2[Pop=="S"])
> fit6
Welch Two Sample t-test
data: expression by Treat
t = 1.1686, df = 13.888, p-value = 0.2622
alternative hypothesis: true difference in means is not equal to 0
95 percent confidence interval:
-4.685627e-11 1.588582e-10
sample estimates:
mean in group C mean in group T
1.283930e-10 7.239206e-11
As you can see in the ANOVA overview and the One way ANOVA for Control samples there is a significant difference between the Fidalgo population and the Dabob and Oyster Bay populations. This difference is only apparent in control samples and does not appear in the treated samples.
The boxplot below exemplifies these findings.
This looks to be of some interest in regards to our population level differences.
You can see the raw data here.
No comments:
Post a Comment