Primers:
| 1612 | GRB2_FWD | AACTTTGTCCACCCAGACGG | JH | 5/21/2015 | 20 | 55 | O.lurida | Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2) | P62994 | |
| 1611 | GRB2_REV | CCAGTTGCAGTCCACTTCCT | JH | 5/21/2015 | 20 | 55 | O.lurida | Growth factor receptor-bound protein 2 (Adapter protein GRB2) (Protein Ash) (SH2/SH3 adapter GRB2) | P62994 |
Reagent Table:
| Volume | Reactions X116 | |
| Ssofast Evagreen MM | 10 | 1160 |
| FWD Primer | 0.5 | 58 |
| REV Primer | 0.5 | 58 |
| 1:9 cDNA | 9 |
- Added reagents from greatest to least volume
- Vortexed
- Centrifuged briefly
- Pipetted 11 ul Master Mix to each tube
- Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
- Centrifuged plate at 2000 rpm for 1 minute
- Ran Program Below
Program:
| Step | Temperature | Time |
| Initiation | 95 C | 10 min |
| Elongation | 95 C | 30 sec |
| 60 C | 1 min | |
| Read | ||
| 72 C | 30 sec | |
| Read | ||
| Repeat Elongation 39 times | ||
| Termination | 95 C | 1 min |
| 55 C | 1 sec | |
| Melt Curve Manual ramp 0.2C per sec Read 0.5 C | 55 - 95 C | 30 sec |
| 21 C | 10 min | |
| End |
Plate Layout:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 |
| DNased 42215 HC1 | DNased 42215 NC1 | DNased 42215 SC1 | DNased 42215 HT1 1 | DNased 42215 NT1 1 | DNased 42215 ST1 1 | NTC |
| DNased 42215 HC2 | DNased 42215 NC2 | DNased 42215 SC2 | DNased 42215 HT1 2 | DNased 42215 NT1 2 | DNased 42215 ST1 2 | NTC |
| DNased 42215 HC3 | DNased 42215 NC3 | DNased 42215 SC3 | DNased 42215 HT1 3 | DNased 42215 NT1 3 | DNased 42215 ST1 3 | NTC |
| DNased 42215 HC4 | DNased 42215 NC4 | DNased 42215 SC4 | DNased 42215 HT1 4 | DNased 42215 NT1 4 | DNased 42215 ST1 4 | NTC |
| DNased 42215 HC5 | DNased 42215 NC5 | DNased 42215 SC5 | DNased 42215 HT1 5 | DNased 42215 NT1 5 | DNased 42215 ST1 5 | |
| DNased 42215 HC6 | DNased 42215 NC6 | DNased 42215 SC6 | DNased 42215 HT1 6 | DNased 42215 NT1 6 | DNased 42215 ST1 6 | |
| DNased 42215 HC7 | DNased 42215 NC7 | DNased 42215 SC7 | DNased 42215 HT1 7 | DNased 42215 NT1 7 | DNased 42215 ST1 7 | |
| DNased 42215 HC8 | DNased 42215 NC8 | DNased 42215 SC8 | DNased 42215 HT1 8 | DNased 42215 NT1 8 | DNased 42215 ST1 8 |
Results:
All samples
NTCs
These curves don't look great. The 3/4 NTCs have amplification with a product that is the same size as the target. This qPCR needs to be re run to see if the data is valid. I went ahead and ran the stats script on the data anyway assuming that the NTCs were accidentally contaminated.
Adjusted Expression Bargraph
Adjusted Statistics Summary
Two Way ANOVA
Call:
aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)
Terms:
Pop Treat Pop:Treat Residuals
Sum of Squares 1.209760e-20 4.221308e-19 7.201400e-21 6.405789e-19
Deg. of Freedom 2 1 2 42
Residual standard error: 1.234985e-10
Estimated effects may be unbalanced
Tukey multiple comparisons of means
95% family-wise confidence level
Fit: aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)
$Pop
p adj
N-H 0.9388267
S-H 0.8500743
S-N 0.6540849
$Treat
p adj
T-C 4.5e-06
$`Pop:Treat`
diff lwr upr p adj
N:C-H:C 0.9998943
S:C-H:C 0.9793619
H:T-H:C 0.0109104
N:T-H:C 0.0674973
S:T-H:C 0.0093246
S:C-N:C 0.9967000
H:T-N:C 0.0205525
N:T-N:C 0.1139468
S:T-N:C 0.0176867
H:T-S:C 0.0672949
N:T-S:C 0.2845566
S:T-S:C 0.0589259
N:T-H:T 0.9791965
S:T-H:T 0.9999999
S:T-N:T 0.9709791
One Way ANOVA comparing Population Controls
Call:
aov(formula = expression ~ Pop, data = rep2res2[Treat == "C"])
Terms:
Pop Residuals
Sum of Squares 8.045000e-21 6.051431e-19
Deg. of Freedom 2 21
Residual standard error: 1.697538e-10
Estimated effects may be unbalanced
> TukeyHSD(fit2)
Tukey multiple comparisons of means
95% family-wise confidence level
Fit: aov(formula = expression ~ Pop, data = rep2res2[Treat == "C"])
$Pop
diff lwr upr p adj
N-H 0.9840303
S-H 0.8632357
S-N 0.9358047
One Way ANOVA comparing Population Treatments
Call:
aov(formula = expression ~ Pop, data = rep2res2[Treat == "T"])
Terms:
Pop Residuals
Sum of Squares 1.125392e-20 3.543572e-20
Deg. of Freedom 2 21
Residual standard error: 4.107816e-11
Estimated effects may be unbalanced
> TukeyHSD(fit3)
Tukey multiple comparisons of means
95% family-wise confidence level
Fit: aov(formula = expression ~ Pop, data = rep2res2[Treat == "T"])
$Pop
p adj
N-H 0.104549
S-H 0.984109
S-N 0.075302
T-Test for DABOB
Welch Two Sample t-test
data: expression by Treat
t = 2.9537, df = 7.1, p-value = 0.02095
alternative hypothesis: true difference in means is not equal to 0
95 percent confidence interval:
4.449457e-11 3.966833e-10
sample estimates:
mean in group C mean in group T
2.429139e-10 2.232492e-11
T-Test for FIDALGO
Welch Two Sample t-test
data: expression by Treat
t = 2.6905, df = 9.489, p-value = 0.02369
alternative hypothesis: true difference in means is not equal to 0
95 percent confidence interval:
2.685431e-11 2.971352e-10
sample estimates:
mean in group C mean in group T
2.284042e-10 6.640939e-11
T-Test for Oyster Bay
Welch Two Sample t-test
data: expression by Treat
t = 3.8083, df = 7.192, p-value = 0.006313
alternative hypothesis: true difference in means is not equal to 0
95 percent confidence interval:
6.887209e-11 2.913015e-10
sample estimates:
mean in group C mean in group T
1.989093e-10 1.882251e-11
There is a strong difference between the treatment and control. This is apparent in every population. The populations though are not statistically different from one another. You can see this in the boxplot generated from the data.
You can see the raw data file here.
No comments:
Post a Comment