7 29 2015 EF1d qPCR 1 & 2

In an effort to find a better normalizing primer than the Actin one I have, I developed 4 possible normalizing primers. Today I ran two replicates of EF1d with a 1:9 dilution of cDNA. 

Primers:

1682	EF1d_FWD	GAACTGCCCACTGATTTGCC	JH	7/22/2015	20	55	60	O.lurida	Elongation factor 1-delta (EF-1-delta)	A5D989
1681	EF1d_REV	TGTGGGGTGAAACACGTTGA	JH	7/22/2015	20	50	60	O.lurida	Elongation factor 1-delta (EF-1-delta)	A5D989

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

Opticon

All

Amp

 Melt Curve

NTCs

Amp

 Melt Curve

CFX 

All

NTCs

The amplification curves in both runs look great. There's no amplification in either set of NTCs. Also the latest amplifying samples were they same in both replicates. I then compared the replicates with the Opticon Correction to see how close are they. 

There is less than a 2 ct difference between the replicates with correction. The there is one major outlier which is likely caused by mechanical error. 

I will tomorrow I will average the Ct values and efficiencies to develop data to normalize expression data for the other targets. Also I've been reading on how to deal with outliers. If I throw out the data, then it screws up the statistics. One way I've seen this dealt with in the literature is to assume that outliers are caused by mechanical/human error and replace the values with the latest Ct value and efficiency found in the data which assumes the lowest observed expression. 

You can see paper here:

Differential gene expression profiling of Listeria monocytogenes in Cacciatore and Felino salami to reveal potential stress resistance biomarkers

• M. Mataragas^a, b, 
• F. Rovetto^a, 
• A. Bellio^c, 
• V. Alessandria^a, 
• K. Rantsiou^a, 
• L. Decastelli^c,
• L. Cocolin^a

http://www.sciencedirect.com/science/article/pii/S0740002014002329

You can see the raw data from the opticon and from the cfx.