7 22 2015 BMP2 qPCR 2

Today I ran duplicates for the targets I ran last week. I'm hoping to get strong replicates for analysis. Here I ran the BMP2 which last week had issues with the NTC. 

Primers:

1640	BMP-2_FWD	TGAAGGAACGACCAAAGCCA	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643
1639	BMP-2_REV	TCCGGTTGAAGAACCTCGTG	JH	5/21/2015	20	55		O.lurida	Bone morphogenetic protein 2 (BMP-2) (Bone morphogenetic protein 2A) (BMP-2A)	P12643

Reagent Table:

	Volume	Reactions X116
Ssofast Evagreen MM	10	1160
FWD Primer	0.5	58
REV Primer	0.5	58
1:9 cDNA	9

1. Added reagents from greatest to least volume
2. Vortexed
3. Centrifuged briefly
4. Pipetted 11 ul Master Mix to each tube
5. Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
6. Centrifuged plate at 2000 rpm for 1 minute
7. Ran Program Below

Program:

Step	Temperature	Time
Initiation	95 C	10 min
Elongation	95 C	30 sec
	60 C	1 min
Read
	72 C	30 sec
Read
Repeat Elongation 39 times
Termination	95 C	1 min
	55 C	1 sec
Melt Curve Manual ramp 0.2C per sec Read 0.5 C	55 - 95 C	30 sec
	21 C	10 min
End

Plate Layout:

1	2	3	4	5	6	7
DNased 42215 HC1	DNased 42215 NC1	DNased 42215 SC1	DNased 42215 HT1 1	DNased 42215 NT1 1	DNased 42215 ST1 1	NTC
DNased 42215 HC2	DNased 42215 NC2	DNased 42215 SC2	DNased 42215 HT1 2	DNased 42215 NT1 2	DNased 42215 ST1 2	NTC
DNased 42215 HC3	DNased 42215 NC3	DNased 42215 SC3	DNased 42215 HT1 3	DNased 42215 NT1 3	DNased 42215 ST1 3	NTC
DNased 42215 HC4	DNased 42215 NC4	DNased 42215 SC4	DNased 42215 HT1 4	DNased 42215 NT1 4	DNased 42215 ST1 4	NTC
DNased 42215 HC5	DNased 42215 NC5	DNased 42215 SC5	DNased 42215 HT1 5	DNased 42215 NT1 5	DNased 42215 ST1 5
DNased 42215 HC6	DNased 42215 NC6	DNased 42215 SC6	DNased 42215 HT1 6	DNased 42215 NT1 6	DNased 42215 ST1 6
DNased 42215 HC7	DNased 42215 NC7	DNased 42215 SC7	DNased 42215 HT1 7	DNased 42215 NT1 7	DNased 42215 ST1 7
DNased 42215 HC8	DNased 42215 NC8	DNased 42215 SC8	DNased 42215 HT1 8	DNased 42215 NT1 8	DNased 42215 ST1 8

Results:

All samples

NTCs

These amplification curves look better than the last run of BMP2. There is some minor amplification in the NTCs but it is larger than the target and is probably an artifact of the PCR process. To analyze these data I ran them through an updated stats and graphs script which runs a Two Way ANOVA and produces a boxplot and expression bar graph. The data did not have its outliers eliminated which worked fine with this as most samples showed some expression. 

Expression Bar Graph

Statistics

Call:

   aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

Terms:

                         Pop        Treat    Pop:Treat    Residuals

Sum of Squares  1.703293e-20 3.032145e-20 2.201442e-20 6.077281e-20

Deg. of Freedom            2            1            2           42

Residual standard error: 3.803908e-11

Estimated effects may be unbalanced

> TukeyHSD(fit)

  Tukey multiple comparisons of means

    95% family-wise confidence level

Fit: aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

$Pop

            diff           lwr          upr     p adj

N-H  0.4089519

S-H  0.0041846

S-N  0.1002050

$Treat

             diff           lwr           upr    p adj

T-C  4.14e-05

$`Pop:Treat`

                 diff           lwr           upr     p adj

N:C-H:C   0.6348257

S:C-H:C   0.0001275

H:T-H:C  0.9973637

N:T-H:C  0.9999701

S:T-H:C  0.9814628

S:C-N:C   0.0134535

H:T-N:C  0.3564950

N:T-N:C  0.5192134

S:T-N:C  0.2393859

H:T-S:C  0.0000292

N:T-S:C  0.0000710

S:T-S:C  0.0000133

N:T-H:T   0.9997768

S:T-H:T  0.9998827

S:T-N:T  0.9953619

There definitely appears a significant difference between treatment and control. From the stats it appears the Oyster Bay population control has significantly larger expression of BMP2 than the other two populations as well as it the Oyster Bay treatment. You can see this in the bar graph generated below.

The most distressing thing about these data is that it doesn't match the graphs from last week. The controls have much lower expression than they did last week which should not have changed between replicates. I reran the previous data with all the outliers but it still doesn't change the statistics. 

Previous Expression Data

Previous Data Stats

Call:

   aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

Terms:

                         Pop        Treat    Pop:Treat    Residuals

Sum of Squares  3.918260e-22 9.723005e-21 1.573763e-21 9.279358e-21

Deg. of Freedom            2            1            2           38

Residual standard error: 1.56267e-11

Estimated effects may be unbalanced

4 observations deleted due to missingness

> TukeyHSD(fit)

  Tukey multiple comparisons of means

    95% family-wise confidence level

Fit: aov(formula = expression ~ Pop + Treat + Pop:Treat, data = rep2res2)

$Pop

                 p adj

N-H   0.4224591

S-H   0.8174685

S-N  0.8189700

$Treat

         p adj

T-C  2e-07

$`Pop:Treat`

                    p adj

N:C-H:C   0.6961640

S:C-H:C  0.9298189

H:T-H:C  0.0032438

N:T-H:C  0.0048368

S:T-H:C  0.2481527

S:C-N:C  0.1806352

H:T-N:C  0.0000405

N:T-N:C  0.0000732

S:T-N:C  0.0140727

H:T-S:C  0.0411016

N:T-S:C  0.0532668

S:T-S:C  0.7297433

N:T-H:T   1.0000000

S:T-H:T   0.7788719

S:T-N:T   0.7991437

The stats don't match which is distressing. Even the boxplots dont seem to match. 

You can see the raw data files for this week here and last week here.