Primers:
| 1688 | GAPDH_FWD | TGCTCCTTGCATTTCCGTCA | JH | 7/22/2015 | 20 | 50 | 60 | O.lurida | Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12) | Q6BMK0 |
| 1687 | GAPDH_REV | CGCTCCTTCCAAGTCTCCAG | JH | 7/22/2015 | 20 | 60 | 60 | O.lurida | Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12) | Q6BMK0 |
| 1686 | Act_FWD | GTTCTCCTGTCGGGTGGAAG | JH | 7/22/2015 | 20 | 60 | 60 | O.lurida | Actin | P53498 |
| 1685 | Act_REV | CACCATGAAACGCCGACTTG | JH | 7/22/2015 | 20 | 55 | 60 | O.lurida | Actin | P53498 |
| 1684 | EFG_FWD | ACCCAAGGACAGGGAGAGTT | JH | 7/22/2015 | 20 | 55 | 60 | O.lurida | "Elongation factor G, mitochondrial (EF-Gmt) (Elongation factor G 1, mitochondrial) (mEF-G 1) (Elongation factor G1) (Protein iconoclast)" | B3MK91 |
| 1683 | EFG_REV | TGTGTCCCCTTGTTGCTCTC | JH | 7/22/2015 | 20 | 55 | 60 | O.lurida | "Elongation factor G, mitochondrial (EF-Gmt) (Elongation factor G 1, mitochondrial) (mEF-G 1) (Elongation factor G1) (Protein iconoclast)" | B3MK91 |
| 1682 | EF1d_FWD | GAACTGCCCACTGATTTGCC | JH | 7/22/2015 | 20 | 55 | 60 | O.lurida | Elongation factor 1-delta (EF-1-delta) | A5D989 |
| 1681 | EF1d_REV | TGTGGGGTGAAACACGTTGA | JH | 7/22/2015 | 20 | 50 | 60 | O.lurida | Elongation factor 1-delta (EF-1-delta) | A5D989 |
| Volume | Reactions X116 | |
| Ssofast Evagreen MM | 10 | 1160 |
| FWD Primer | 0.5 | 58 |
| REV Primer | 0.5 | 58 |
| 1:9 cDNA | 9 |
- Added reagents from greatest to least volume
- Vortexed
- Centrifuged briefly
- Pipetted 11 ul Master Mix to each tube
- Pipetted 9 ul of 1:9 cDNA each column using a channel pipetter
- Centrifuged plate at 2000 rpm for 1 minute
- Ran Program Below
Program:
| Step | Temperature | Time |
| Initiation | 95 C | 10 min |
| Elongation | 95 C | 30 sec |
| 60 C | 1 min | |
| Read | ||
| 72 C | 30 sec | |
| Read | ||
| Repeat Elongation 39 times | ||
| Termination | 95 C | 1 min |
| 55 C | 1 sec | |
| Melt Curve Manual ramp 0.2C per sec Read 0.5 C | 55 - 95 C | 30 sec |
| 21 C | 10 min | |
| End |
Plate Layout:
| EFG | EF1D | GAPDH | Actin |
| 1 | 2 | 3 | 4 |
| NTC | NTC | NTC | NTC |
| DNased 42215 HC8 | DNased 42215 HC7 | DNased 42215 HC6 | DNased 42215 HC5 |
| DNased 42215 NC8 | DNased 42215 NC7 | DNased 42215 NC6 | DNased 42215 NC5 |
| DNased 42215 SC8 | DNased 42215 SC7 | DNased 42215 SC6 | DNased 42215 SC5 |
| DNased 42215 HT1 8 | DNased 42215 HT1 7 | DNased 42215 HT1 6 | DNased 42215 HT1 5 |
| DNased 42215 NT1 8 | DNased 42215 NT1 7 | DNased 42215 NT1 6 | DNased 42215 NT1 5 |
| DNased 42215 ST1 8 | DNased 42215 ST1 7 | DNased 42215 ST1 6 | DNased 42215 ST1 5 |
| NTC | NTC | NTC | NTC |
Results:
EFG
Amp
Melt Curve
EF1d
Amp
Melt Curve
GAPDH
Amp
Melt Curve
Actin
Amp
Melt Curve
The best primer looks like it EF1d as the curves are strong and the melt curve is tight. EFG is second best, good curves and ok melt curve. Actin is third best, amplification curves are weak as well as the melt curve. GAPDH failed to amplify.
So I'm going to run EF1d tomorrow.
You can see the raw data here.








No comments:
Post a Comment